חם בחוץ? חם גם אצלנו! הקייטנה הווירטואלית של מכון דוידסון יוצאת לדרך. חודש של פעילויות, חידות, המלצות לטיולים, ניסויים, והכול (כמעט) בלי לצאת מהמזגן. הצטרפו אלינו: בכל יום נוסיף פעילות חדשה בדף הקייטנה, השלמתם הכול? מעולה – הרווח כולו שלכם :)

31/07

זהו, יולי כמעט מאחורינו ולפעילות האחרונה שלנו הכנו עבורכם פעילות DNA מגניבה - 

אז מה עושים?

ראשית צפו בסרטון “ריצוף הגנום” שבקישור: https://goo.gl/iE3QMn.

לאחר שצפיתם בסרטון, קראו את הסיפור על החולד והחפרפרת ונסו לענות על השאלה בסוף הסיפור.

סיפור החולד והחפרפרת

במהלך טיול כיתה בנגב המערבי צילמה קבוצת מטיילים צעירים תמונה שבה נראות תלוליות עפר תחוח. אחד הילדים שאל: מי גרם להיווצרות התלוליות?

מטייל אחר ענה לו בבדיחה: "זאת תופעה שבה האדמה מחלידה."

המדריך אמר שרק בעלי חיים החיים מתחת לפני האדמה מסוגלים לעשות זאת, ושיש שני בעלי חיים כאלה שיכולים ליצור את התלוליות: החולד והחפרפרת. המדריך הציע שהתלמידים יחפרו בתלוליות ויחפשו עדויות לבעלי חיים אלה.

התלמידים החלו לחפור בתלוליות. כדי להקל על פעולות החיפוש הם קיבלו מידע ותמונות על החולד ועל החפרפרת.

קראו את המידע (המידע והתמונות לקוחים מוויקיפדיה):

חולד ארצישראלי

מכרסם החי במחילות מתחת לפני האדמה. גופו גלילי, מוארך ומכוסה בפרווה קצרה וצפופה. הוא נטול זנב ואיברים בולטים אחרים כאפרכסות אוזניים. העיניים שקועות תחת עור הגולגולת ומכוסות בקרום דק, אך החולד מסוגל להבחין בין אור לחושך. החולד מצויד בשיניים תחתונות ארוכות הבולטות מהפה. בעזרתן הוא מפורר את האדמה ומרחיב את מחילתו. בעזרת גפיו הקדמיות והאחוריות הוא מסלק את העפר לאחוריו, אז מסתובב ובעזרת ראשו השטוח דוחף אותו אל מחוץ למחילה. החולד צמחוני וניזון בעיקר מפקעות, משורשים ומבצלים שאותם הוא מוצא בשעת החפירה.

חפרפרת

לחפרפרת לרוב פרווה חומה ועבה. היא שוכנת מתחת לפני הקרקע וממעטת לצאת מעליהם, ומשום כך איבדה את יכולת הראייה כמעט לחלוטין, שכן עיניה קטנות מאוד. במהלך חייה היא בונה מערכת מסועפת של מחילות. במקום עיניה, החפרפרת משתמשת באפה ובאוזניה על מנת למצוא את מזונה – חרקים ושלשולים. חוש הריח של החפרפרת מאפשר לה לזהות לא רק את טיבו של מקור הריח, אלא גם לאתר את מקומו בצורה מדויקת. אפה הרגיש מסוגל להתחקות אחר דרכו של השלשול, מזונה העיקרי, באדמה. החפרפרות משוטטות במנהרותיהן ללא הרף ומחפשות שלשולים, תולעים ובעלי חיים זעירים אחרים למאכל. לאחר חיפוש וחפירה בתלוליות, מצאו הילדים כמה שערות פרווה. הם התבוננו בשערות מקרוב, אך אי אפשר היה לענות לשאלה: האם זהו החולד שאחראי ליצירת התלוליות או שמא זו החפרפרת? אחד התלמידים אמר: "הגנים מתורגמים לתכונות הייצור החי. אם נתרגם את הגנים הנמצאים בתאים שבבסיס השערות במצאנו, נדע מה התכונות של היצור החי וכך נדע אם השערות שנמצאו שייכות לחולד או לחפרפרת.לכן ביקשו התלמידים מהמדריך לקחת את אותן שערות לבדיקה במעבדה לזיהוי גנים.

 

הגן הראשון שזוהה היה:

​AAATCCCCCAGAAGCGCCTTT

כדי לתרגם את הגנים שזוהו עליכם להשתמש בטבלת הקוד הגנטי. בטבלה זו כל שלושה נוקלאוטידים מהגן מקודדים לאות בשפה העברית.

גן שני שזוהה היה:

AAATTGCCGCGTCAAAGTTACCCTTTT

בתא החי הגנים יוצרים תכונות בכך שכל גן הוא שרשרת קודים (שלושה נוקלאוטידים), המקודדים לחומצות אמיניות חומצות האמינו מצטרפות להרכבת חלבון המרכיב את גופו של הייצור החי. הטבלה הבאה מציגה את הקוד הגנטי ואפשר לראות בעזרתה כיצד נעשית מלאכת התרגום בתא החי:

אז מה אומרים? חולד או חפרפרת?

כתבו לנו בתגובות!

נהננו מאוד! מקווים שגם אתם :)

30/07

החידה של יום שני

אגסים ותפוחים
בחממה הניסויית במאדים יצרו הבוטנאים עץ המניב גם אגסים וגם תפוחים.
לעובדים בחממה מותר לקטוף פירות לפי החוקים הבאים:
אסור לקטוף יותר משני פירות בבת אחת.
אם קוטפים פרי אחד, גדל במקומו פרי אחד מאותו סוג.
אם קוטפים שני פירות מסוג אחד, למשל, שני תפוחים, גדל במקומם אגס אחד.
אם קוטפים אגס ותפוח, גדל במקומם תפוח אחד.
משלחת של אורחים מכדור הארץ הגיעה לסיור בחממה ומצאה על העץ 20 אגסים ו-35 תפוחים.
הם החלו לקטוף את הפירות, ובסוף היום נשאר על העץ פרי אחד בלבד.
מהו הפרי הנותר? כתבו לנו בתגובות את התשובה!

החידה פורסמה לראשונה במסגרת מתמטיקה בהתכתבות

29/07

היום בקייטנה נעשה קסם מדעי מגניב בעזרתו נגרום לפחית לקפוץ מכוס אחת לכוס שניה. כל מה שצריך לקסם זה פחית שתייה ושתי כוסות שהפחית יכולה להכנס בהן.

להסבר המלא לחצו כאן
לניסויים נוספים בקרו במדע בבית

 

26/07

הטיול המדעי שלנו לסופ"ש - המדריך לאסטרונום: מה כדאי לראות בעת ליקוי הירח

ד"ר דוד פולישוק

ב-27 ביולי ייראה מישראל ליקוי ירח מלא, שיציע מופע אסטרונומי מרהיב לכל המשפחה. במהלך הליקוי, הירח המלא ייכנס לאיטו אל צילו של כדור הארץ, ולכן אור השמש לא יגיע אליו ישירות והוא ילך ויחשיך עד שלצופה ידמה כאילו הירח נעלם. אבל בטרם ייעלם סופית, הירח יאדים מאוד.

למה יאדים? מכיוון שמעט אור שמש עדיין יצליח להגיע אליו, אחרי שיעבור בזווית שטוחה באטמוספרה של כדור הארץ, שתהפוך למעין מסנן שמעביר רק את החלק האדום של אור השמש ומפזר את שאר הצבעים לכל הכיוונים. תופעה דומה מתרחשת כשהשמש שוקעת ואורה עובר שכבת אוויר עבה יותר.

בהנחה שעננים לא יפריעו לתצפיות, צפייה בליקוי תהיה חוויה מרשימה בלי צורך לצאת מהעיר או להשתמש בציוד מיוחד – מספיק שתרימו את ראשכם ותביטו לכיוון דרום-מזרח, שם יימצא הירח כשהליקוי יתחיל ב-21:24. הליקוי יגיע לשיאו ב-23:23, ויסתיים ב-1:20 לפנות בוקר, כשהירח כבר יעבור לצד המערבי של השמיים.

מצעד של כוכבים

אם אתם כבר בחוץ, או לפחות על המרפסת, למה לא תיהנו מעוד כמה תופעות אסטרונומיות? הקיץ, למשל, כוכבי הלכת מסודרים במצעד מרשים לרווחת הצופה. עם השקיעה תוכלו לזהות בקלות במערב את כוכב הלכת נוגה, שיהיה הכוכב הבהיר ביותר בשמיים. מכיוון שמסלולו נמצא בין השמש לכדור הארץ, הוא תמיד ייראה מכאן קרוב יחסית לשמש: מזרחית (או משמאל) לשמש השוקעת, או מערבית (מימין) לה בזמן הזריחה. בקיץ הזה נוגה שוקע אחרי השמש, והמרחק הזוויתי המרבי בינו לבין השמש מגיע לכ-45 מעלות, מה שיאפשר לנו לצפות בו לכמה שעות בין שקיעת החמה לשקיעת נוגה עצמו.

אם תסבו את מבטכם מזרחה, בשמיים הדרומיים, תבחינו בקלות בכוכב הלכת צדק, שגם הוא בהיר מאוד בתקופה הזאת. בזמן שקיעת השמש הוא יימצא בדרום, כמעט בשיא גובהו. בגלל גודלו העצום, שטח הפנים של צדק מחזיר קרינת שמש רבה ואפשר להבחין בו אפילו כשברקע זורח אורו החזק של הירח המלא.

אם תצפו בצדק בטלסקופ קטן, תוכלו להבחין בארבעת הירחים הגדולים שלו – איו, אירופה, גנימד וקליסטו. מכיוון שמישור התנועה שלהם סביב צדק כמעט חופף למישור המילקה, שהוא המישור שבו נעים בין השאר כדור הארץ וצדק, נדמה במהלך הצפייה כאילו ארבעת הירחים נעים על קו ישר שעובר דרך כוכב הלכת הגדול.

כעת אתם מוזמנים להפנות את מבטכם עוד יותר מזרחה. בערך בשני שליש הדרך בין צדק לירח תגלו את שבתאי. אורו יהיה חלש יותר מזה של צדק, אבל תוכלו לזהות אם תחפשו היטב לאורך אותה קשת דמיונית שמחברת את צדק לירח.

אל תתבלבלו בין שבתאי לכוכב אחר שבהירותו דומה לשבתאי ונמצא באמצע הדרך בין צדק לשבתאי צדק. זהו אנטארֵס, כוכב אדום, ענק בסוף חייו, שנמצא הרחק מחוץ למערכת השמש שלנו. כדי להבדיל ביניהם שימו לב שאנטארס אדום יותר משבתאי, ונמצא מתחת לקשת הדמיונית שמחברת את כוכבי הלכת.

אנטארס הוא הכוכב הבהיר ביותר בקבוצת עקרב, אבל אורו הבהיר של הירח המלא יקשה עליכם בשאר כוכבי הקבוצה. ובכל זאת, בעיצומו של ליקוי הירח המלא, כשעוצמת אורו של הירח תפחת משמעותית, תוכלו לנסות לזהות את שאר הכוכבים בקבוצה, שנמתחים בקו דמיוני מאנטארס לכיוון דרום-מזרח בצורת סימן שאלה – העוקץ של העקרב.

מאנטארס ושבתאי המשיכו מזרחה עד לירח המלא. ממש מתחת לו תמצאו כוכב בהיר מאוד שצבעו כתמתם. זהו מאדים, שכנו הקרוב של כדור הארץ. ב-27 ביולי יגיע כוכב הלכת לשיא בהירותו מאז אוגוסט 2003.

יש קשר ישיר בין העובדה שמאדים כל כך בהיר בערב הזה לכך שליקוי הלבנה מתקיים באותו מועד – בשני המקרים העצם חייב להימצא ב"ניגוד" (opposition), כלומר מבחינת מי שצופה מכדור הארץ, הירח ומאדים יהיו בדיוק בכיוון ההפוך לכיוונה של השמש. במצב של ניגוד נראה מכאן את כל חציו המואר של מאדים, ורק במצב של ניגוד הירח יכול להיכנס לצילו של כדור הארץ. שימו לב שבעוד הירח נמצא בניגוד פעם בחודש (29.5 ימים ליתר דיוק), מאדים נמצא באותו מצב רק פעם ב-779 ימים. כלומר תופעה כזאת, שבה הירח ומאדים שניהם יחד בניגוד, תחזור על עצמה רק בעוד כ-60 שנה.

לבסוף הפנו את המבט בחזרה מערבה וחברו בקשת דמיונית את השמש ששקעה, נוגה, צדק, שבתאי, מאדים והירח. נסו לדמיין שהקשת הזאת היא חתך של מישור עם שמי הלילה, שכוכבי הלכת והשמש נמצאים על פניו ונעים בו. זהו מישור המילקה, או מישור הליקויים, שקיבל את שמו מאחר שכאשר הירח חוצה אותו ייתכנו ליקויי ירח או ליקויי חמה. כשכוכבי הלכת מסודרים זה אחר זה לנוחיות הצופה, קל לזהות את מיקומה של מערכת השמש בשמיים, ולהפנים עד כמה גדולה השכונה החללית שלנו.

 

25/07

והיום בקייטנה - הטבלה המחזורית

הטבלה המחזורית, בצדק רב, נחשבת אחת מיצירות המופת של המדע המודרני והיום נגלה למה.

היכנסו לקישור וענו על החידות שבהמשך-

הגאוניות שמאחורי הטבלה המחזורית

פתרו את החידות הבאות:

 

רוצים עוד?

הורידו עכשיו את אפליקציית המוח והמוח ג'וניור

אנדרואיד:

https://play.google.com/store/apps/details?id=il.ac.weizmann.davidson.thebrain

אייפון:

https://itunes.apple.com/il/app/%D7%94%D7%9E%D7%95%D7%97/id972446348?mt=8

 

24/07

קשים ונהנים

שערו:

כיצד אפשר  לגרום לקש שתייה או שיפוד לזוז מבלי לגעת בו ישירות?

ציוד וחומרים

שתי קשיות עם "מפרק" מתקפל        

שיפוד                                   

פיסת נייר סופג                     

פלסטלינה                            

כף חד-פעמית                      

 

מה עושים?

הכנה

1.      חתכו את "ראשה" של כף הפלסטיק.

2.      העמידו את ראש הכף על השולחן כך שצדו הקעור כלפי מעלה (כמו קערה).

3.      שימו מעט פלסטלינה בכף, ותקעו בה שיפוד כך שהוא לא ייגע בשולחן.

 

הניסוי

4.      האם אפשר להזיז את השיפוד בעזרת קשית מבלי שהיא תיגע בשיפוד?

5.      קרבו את הקשית שבידכם לשיפוד, אך אל תגעו בו. נסו לסובב את השיפוד ללא מגע.

6.      האם הצלחתם? כתבו לנו בתגובות

7.      כעת, החזיקו בידכם את הקשית, ובעזרת פיסת נייר סופג שפשפו אותה היטב.

8.      מה יקרה אם תקרבו כעת את הקשית לשיפוד? כ

9.      קרבו את הקשית שבידכם לשיפוד, אך אל תגעו בו. נסו לסובב את השיפוד ללא מגע.הצלחתם? שתפו אותנו!

 

להסברים נוספים

ניסוי זה נערך במסגרת פעילות גלי קול של מסלול שביט למצויינות מדעית
 

23/07

החידה של יום שני

הנוסע האחרון

קבוצת אנשים עולים בבסיס מאדים על טיסה לירח פובוס:
הנוסע הראשון עולה לחללית ואז מתברר שאיבד את
כרטיס העלייה. הוא נכנס לחללית ותופס מקום
באופן אקראי. הנוסעים האחרים עולים לחללית זה אחר זה.
אם המקום שלהם תפוס הם יושבים במקום אקראי ואחרת הם יושבים במקום שיועד להם.
אילו מקומות יישארו לנוסע האחרון? רמז: יש שתי אפשרויות בלבד

כתבו לנו את התשובה שלכם בתגובות!

22/07

איך לבנות, איך לזרוק ואיך עובד בורמרנג

הבוקר בקייטנה של דוידסון נבנה בוּמרנג ונלמד כיצד ליידות אותו נכון כך שיעוף במעגל ויחזור אל הזורק, לא מומלץ לנסות בבית אם אתם לא רוצים לעצבן את ההורים :)

 

למידע והסברים בקרו כאן
לניסויים נוספים בקרו במדע בבית

 
 

19/07

טיול מדעי לסופ"ש- מסלול במעלה זרון

יונתן גרופ

ים המלח הוא הנקודה הנמוכה ביותר על פני כדור הארץ. במהלך התזוזה של לוחות היבשת של ערב וסיני, לפני כ-5 מיליוני שנים, נפער ביניהם בור עמוק, שברובו התמלא באדמת סחף. ים המלח יושב בדיוק בליבו של הבור הזה, בינות לצוקי סלע אדירים.

כיאה לאתר כה ייחודי, ים המלח מוקף במסלולי טיול רבים. מסלול מעלה זרון הולך בעקבותיו של נתיב סחר קדום. הוא יורד בנוחות מבמת מדבר יהודה עד לאגן הדרומי של ים המלח, ומגיע לחופי נווה זוהר.

הגעה למסלול: נוסעים בכביש 31 מערד לים המלח. אחרי הקילומטר ה-35 פונים צפונה לשביל מסומן שחור, עביר לכל רכב. לאחר כ-600 מטרים פונים ימינה בשביל מסומן כחול לכיוון מזרח, ונוסעים כ-1.6 קילומטרים. מחנים את הרכב במפגש עם שביל מסומן אדום, עביר להולכי רגל בלבד.

הליכה במסלול: יורדים בשביל האדום דרומה לאורך כ-3.2 קילומטרים, עד למצד זוהר. משם ממשיכים עם השביל הכחול מזרחה עד לכביש 90. אורך מסלול ההליכה הוא כ-5 קילומטרים בירידה מתונה. המסלול מתאים למיטיבי לכת בלבד! כדאי להחנות רכב נוסף בסוף המסלול.

משך המסלול: כשלוש שעות.

חשוב! המסלול ברובו חשוף לשמש, ולכן אין ללכת בו בימים חמים במיוחד, ומומלץ להעדיף את שעות הבוקר או אחר הצהריים. יש לשאת לפחות שלושה ליטרים מים לאדם.

 

בסמוך למקום שבו החנינו את הרכב נמצא אתר קידוח הנפט בצוק תמרור. בתחילת שנות האלפיים, התגלה באתר זה נפט בעומק מאות מטרים מתחת לפני הקרקע. למרות התנגדות הגופים הירוקים, החל במקום קידוח מסחרי בשנת 2014; הקידוח נעצר כשנה אחר כך, כשהתברר שהנפט שבאתר מהול במים, וההפרדה ביניהם אינה כדאית כלכלית. הנפט אינו הדלק המאובן היחיד באזור: כמה קילומטרים מאתר זה נמצאים קידוחי הגז הטבעי של רכס זוהר, שסיפקו במשך עשרות שנים גז למפעלים ולבתים של העיר ערד – זמן רב לפני גילויי הגז הטבעי בים התיכון.

השביל האדום הולך בעקבות נתיב קדום שירד מדרום הר חברון אל ים המלח, ומכונה מעלה זרון. דרך זו הייתה כנראה בשימוש כבר בתקופת הברונזה, וזוהתה כאחד הנתיבים שבהם עברו סוחרים ומצביאים מהאזור המכונה כיום ארץ ישראל לעבר הירדן המזרחי. השביל עובר במקום לא במקרה: השלוחה שעליה תלכו במסלול היא בעלת השיפוע המתון ביותר מבין השלוחות היורדות לים המלח באזור זה. לפיכך, התנועה באזור התנקזה אליה באופן טבעי, לאורך כל שנות ההיסטוריה.

השביל, המתחיל בגובה של כ-60 מטרים מעל לפני הים, מסתיים כ-340 מטרים מתחת לפני הים, וכולל כמה נקודות תצפית לעבר האגן הדרומי של ים המלח. האגן הדרומי הוא כיום אגם מלאכותי לחלוטין, שמימיו נשאבים מהאגן הצפוני והמפלס שלו גבוה ממנו בכמה עשרות מטרים. הבריכות הנראות מהמסלול משמשות את ישראל וירדן להפקת מחצבים. נתרן כלורי, הנקרא גם מלח שולחן, הוא אולי המחצב המוכר ביותר, אך חשיבותו הכלכלית שולית ביחס לברום, אשלגן ומגנזיום, שלצורך הפקתם מְאַדִים את מי הים מן הבריכות שמולכם.

מפלס ים המלח השתנה מאוד במאות אלפי השנים האחרונות. לפני כ-25 אלפי שנים, במהלך תקופת הקרח האחרונה, הגיע מפלס הים לגובה של 160 מטרים מתחת לפני הים, כ-240 מטרים מעל המפלס הקיים! עדויות לכך ניתן למצוא במצוקי מדבר יהודה, ששימרו משקעים של הים הקדום הרבה מעל למפלס הנוכחי. מפלס ים המלח יורד כיום בקצב מהיר מאוד של כמטר בשנה, בעיקר בשל חסימת מקור המים שלו, הירדן, וכן הנחלים הזורמים אל הירדן – בעיקר הירמוך. גם ייבוש הים לצורך הפקת מחצבים תורם לירידת המפלס, אך זהו כנראה לא הגורם המרכזי.

בסוף הירידה מתנשא מעל לערוץ מצד זוהר, מבנה שהיה פעיל במהלך התקופה הממלוכית, במאות ה-13 עד ה-15 לספירה, ושימש לשמירה על סעיף משני של דרך הדואר הממלכתית, בין עזה לעיר כרך שבעבר הירדן המזרחי. באזור יש שרידים של מבנים שמקורם בתקופה ההלניסטית ואילך, המעידים על חשיבות הדרך לאורך השנים. המים למצד זוהר נאגרו בעזרת סכר קטן הנמצא ממש בקצה השביל האדום, רגע לפני הירידה לשביל הכחול. מתחת למצד יש קבוצת עצי שיטה, מצוינים לעצירה ממושכת.

 

כמה מלח יש בים המלח?

לאחר שהגענו למכונית, ניסע כמה דקות אל חופי המלונות של נווה זוהר, כדי לטבול באגם הנמוך ביותר בעולם. ים המלח הוא מקום מצוין כדי לבדוק את סוגיית הציפה. כולנו יודעים שאם ניכנס לאמבטיה, מפלס המים יעלה בהתאם לנפח גופנו. זו, אגב, שיטה מצוינת למדידת נפח של גופים בעלי צורות משונות. אבל מה קורה במקווה מים גדול יותר, שבו אנחנו לא נוגעים בקרקעית?

כשאנו נשכבים על פני המים וגופנו טבול לגמרי בתוכם, אנו דוחקים מים הצידה, כאמור – בנפח השווה לנפח גופנו. המדד הנוח לשימוש הוא הצפיפות, שהיא היחס בין המשקל לנפח. היחס בין צפיפות גופנו לצפיפות המים שאנו דוחקים הצידה יקבע אם נצוף או נשקע. אם צפיפות הגוף שווה לצפיפות המים שדחקנו או קטנה ממנה, נצוף. אם הצפיפות שלנו גדולה יותר, נשקע. ככל שהפער גדול יותר, כך נצוף או נשקע בקלות יותר.

ים המלח, כידוע, מלוח במיוחד. כמה בדיוק? מי ים המלח מכילים 34.2% מלח, יותר משליש ממשקל המים, בריכוז גבוה פי עשרה מריכוז המלח בים התיכון. מי ים המלח הם, לפיכך, צפופים במיוחד. ככל שהמליחות גבוהה יותר, כך גם הצפיפות, מכיוון שמשקלם המולקולרי של המלחים המומסים גבוה יותר משל המים. ליטר מי ים המלח שוקל כ-1,240 גרם, בעוד שליטר מים מזוקקים שוקל 1,000 גרם בלבד. גוף האדם מכיל כ-70 אחוז מים בריכוז מומסים נמוך, שצפיפותם קרובה לצפיפות של מים מזוקקים.

כשאנו נשכבים על פני המים, חלקנו התחתון מפעיל כוח כלפי מטה, כתוצאה מהכבידה של כדור הארץ. כוח זה נתקל בכוח הציפה, הפועל כלפי מעלה. כוח הציפה מנוגד בכיוונו לכוח המשיכה, ונובע מהפרש הלחצים שנוצר בעמודת המים – ככל שיורדים עמוק יותר במים, הלחץ עולה. הציפה נקבעת על פי הפרש הלחצים בין חלקו העליון של החפץ הטבול לחלקו התחתון. בים המלח, הצפיפות שלנו קטנה מצפיפות המים שדחקנו הצידה, ולכן כוח הציפה גדול יותר מכוח המשיכה, ואנחנו צפים בקלות רבה. ניתן לצוף גם בים התיכון, או בים סוף, אך פחות בקלות. אנו מסוגלים לצוף אפילו בכנרת, שהצפיפות של מימיה כמעט זהה לזו של גוף האדם; אך ככל שהפרש הצפיפויות קטן יותר, כך קשה יותר לצוף על פני המים.

תהנו וספרו לנו איך היה!

18/07

ספגטי משוקולד

היום בקייטנה במקום לשתות שוקו נאכל אותו :-) לא צריך קמח או בכלל בצק אלא רק שוקו ופלקסיג'ל...
למידע נוסף והסברים על המתכון לחצו כאן
למתכוני בישול מולקולרי נוספים לחצו כאן

 

17/07

על האש

גלו אחת ולתמיד, מה הסיפור של האש: מי "המציא" אותה, איך היא עובדת ומדוע היא מסוכנת? וכן, יש גם ניסויים! פעילות מקוונת ללא תשלום (מצריכה הרשמה) לכל מי שרוצה להסתכל לאש בעיניים

 

 

16/07

החידה של יום שני - 

מי אסף יותר עפרות מתכת?
בתחנת המחקר במכתש סקיאפרלי יש שישה רובוטים גיאולוגיים, והם נשלחו לאסוף כמה שיותר עפרות מתכת. האסטרונאוטיות ולנטינה, סבטלנה וסאלי התערבו איזה רובוט יאסוף יותר עפרות, וכל אחת רשמה את הניחוש שלה.
הניחוש של ולנטינה (A,B,C,D,E,F)  - כלומר A יאסוף הכי הרבה עפרות, אחריו B ואחרון F.
הניחוש של סבטלנה (A,C,B,F,E,D)  ושל סאלי (C,E,F,A,D,B).
בתום התחרות התברר שוולנטינה ניחשה שלושה מקומות נכונים, אך לא ניחשה אף זוג רובוטים שסיימו זה אחר זה בדירוג. סבטלנה לא ניחשה אף ניחוש נכון, וסאלי ניחשה ניחוש נכון אחד בלבד.
מה הסדר הנכון של כמות העפרות שהרובוטים אספו? כתבו לנו בתגובות

 

החידה פורסמה לראשונה במסגרת מתמטיקה בהתכתבות

15/7

השבוע השני של הקייטנה מתחיל עם חידון על השכן הג'ינג'י שלנו - מאדים. נסו לענות על השאלות וכתבו לנו בתגובות על כמה שאלות הצלחתם לענות. 
לא עניתם על הכל נכון? לא נורא יש לנו מדור שלם מלא בכתבות על מאדים

רוצים לחוות ביקור למאדים? בואו לתערוכה "סיבוב על מאדים" אצלנו בגן המדע להזמנת כרטיסים לחצו כאן

 

 

12/7

טיול מדעי והפעם - קיר האמוניטים במכתש רמון

מכתש רמון הוא המכתש הגדול מסוגו בעולם, ושייך לקבוצה ייחודית של מכתשים שנוצרו כתוצאה מבלייה ולא מפגיעת מטאור. נציגיה הבולטים של קבוצה זו נמצאים אצלנו, בנגב, ובהם גם המכתש הגדול והמכתש הקטן. מסלול ההליכה לקיר האמוניטים נמצא על דופנו הדרומית של מכתש רמון, ובפועל עובר מחוץ למכתש עצמו.

מסלול

חונים בחניון שליד כביש 40, בין הקילומטר ה-84 ל-85, כ-14 קילומטרים דרומית לכיכר האחרונה של העיירה מצפה רמון. במקום יש שילוט מהכביש, והמסלול מסומן בצבע אדום. הירידה למסלול נמצאת בצד המערבי של הכביש; הימנעו מלחצות את הכביש ברגל, כיוון שמכוניות נוסעות כאן במהירות רבה. לאחר הליכה של כקילומטר לכיוון מערב, השביל מגיע לאתר האמוניטים. משם ניתן לחזור אל הרכב; לחלופין, מיטיבי הלכת שביניכם יכולים לחזור כ-150 מטרים מזרחה, לפנות צפונה בשביל המסומן ירוק/שביל ישראל, לעלות לתצפית בנקודת גובה 666 ומשם לרדת בחזרה לכביש 40.

משך המסלול הלוך וחזור: כ-40 דקות של הליכה קלה ללא מכשולים.

משך המסלול המעגלי, הכולל עלייה לנקודת גובה 666: כשעתיים (למיטיבי לכת בלבד).

קיר האמוניטים ניצב כיום בזווית חדה יחסית, אך בעבר הקדום היה הקיר הזה קרקעית של ים רדוד, בעומק של כעשרות עד מאות מטרים. המאובנים שבאתר הם של אמוניטים, טורפים קדומים בעלי קונכייה שנכחדו יחד עם הדינוזאורים, לפני כ-65 מיליוני שנים. לאחר שמתו, שקעו האמוניטים לקרקעית האוקיינוס ונבלעו במשקע הבוצי והרך. עם חלוף הזמן, התגבש המשקע והפך לסלע גיר קשה. קונכיות האמוניטים, הבנויות ממינרל הדומה בהרכבו לסלע הגיר, הפכו בעצמן לסלע גיר, אך שמרו על צורתן המקורית. אם חותכים את המאובנים, אפשר לעיתים לזהות את המבנה הפיזיולוגי הפנימי שלהם, שנשמר למרות תהליך ההתאבנות הממושך (שימו לב, מאובנים הם ערכי טבע מוגנים! אם אינכם חוקרי מאובנים, אסור לשבור או לקחת אותם!). ניתן למצוא מאובנים כמעט בכל סלע משקע, כמו גיר, קירטון וצור, אך נדיר למצוא מקבץ כזה של מאובנים גדולים החשופים על פני השטח.

כמה עשרות מיליוני שנים לאחר שהאמוניטים מתו ושקעו בבוץ הרך, שהפך לסלע, התחוללו התרוממות והתקמטות של שכבות הסלע הקשה, עקב תנועת לוחות היבשה של אפריקה צפונה לעבר אסיה. הזווית הנטויה של שכבת הסלע שבה נמצאים האמוניטים, שהייתה בעבר אופקית לחלוטין, מעידה על קיומו של רכס הרים קדום. הרכס הקדום הזה נעלם, ובמקומו נמצא היום מכתש רמון.

 

מתכון להכנת מאובנים בבית

הערה: המאובנים שבקיר האמוניטים נוצרו כנראה בדרך שונה מזו המתוארת כאן – לא מדובר בתבליט של הקונכייה שנעלמה, אלא בקונכייה עצמה שעברה תהליך של התאבנות. מכיוון שתהליך זה נמשך מאות אלפי שנים, נכין את המאובנים בבית בדרך אחרת.

המרכיבים הדרושים

-     כוסות/קערות חד-פעמיות

-     חימר

-     אבקת גבס

-     מים

-     מקל לערבוב

-     חיות פלסטיק/קונכיות בעלות צורות מעניינות

הנחיות

1.   מלאו חצי מהכוס/הקערה בחימר והדקו היטב.

2.   הדקו את חיות הפלסטיק/הקונכיות אל החימר, והוציאו אותן בעדינות כך שישאירו את חותמן.

3.   ערבבו בכוס נפרדת גבס ומים, עד שתקבלו תערובת במרקם סמיך יחסית.

4.   שפכו את תערובת הגבס לכוס/קערה, ויבשו במשך כ-24 שעות.

5.   חתכו את הכוס והפרידו בעדינות בין הגבס לחימר. יצרתם מאובן!

תמונה של מאובני אמוניטים מShutterstock

 

11/7

בהמון מוזיאונים אפשר למצוא מאובנים של חיות קדומות כמו דינוזאורים, או אמוניטים עתיקים וליד כל אחד כתוב מתי הוא היה חי. בשביל להעריך את גיל המאובן משתמשים בשיטה בשם "תארוך רדיואקטיבי" בעזרתה מודדים כמה קרינה פולטים חומרים מסויימים ולפי קצב הפירוק שלהם אפשר להעריך מתי המאובן נוצר. היום בקייטנה נשחק קצת עם מאובנים (וירטואלית כמובן). בשביל לשחק לחצו על התמונה מתחת, ותפעילו את היישומון ששם. היישומון עובד רק על מחשב (לא סמרטפון) וצריך לוודא שתכנת JAVA מעודכנת אצלכם (לכו לפי ההוראות). למידע נוסף על מאובנים (ועל היישומון) בקרו בכתבה שלנו
 

 

10/07

הפעם בקייטנה נבנה צוללת בבקבוק הקרויה גם "צוללן קרטזי". יצירה שלא לוקח הרבה זמן לבנות (לתשומת לב ההורים גם לא מלכלך). כל מה שצריך זה בקבוק פלסטיק, טפי (הטפטפת שמשתמשים בה לויטמינים לילדים) או פקק של עט עם חתיכת פלסטלינה. הניסוי מדגים את עקרון הציפה שמשתמשים בו צוללנים, צוללות ואפילו כדורים פורחים. נסו בעצמכם לבנות את הצוללת וכתבו לנו בתגובות איך הלך!

ניתן לבוא לבקר אצלנו בגן המדע ולראות צוללן קרטזי אמיתי
למידע נוסף והסברים על היצירה

 

09/07

במסע הארוך למאדים, יש סדר קבוע סביב שולחן החללית:
•    אלן אינו יושב משמאלו של גאס.
•    ג'ון אינו יושב מימינו של אלן.
•    סקוט אינו יושב מול גאס.
מהו סידור החברים סביב השולחן? כתבו לנו בתגובות

החידה פורסמה לראשונה במסגרת מתמטיקה בהתכתבות

08/07

יום ראשון הגיע והפעם ניסוי חמוד. נכון שתמיד רציתם מיקרוסקופ משלכם? עכשיו תוכלו לבנות מיקרוסקופ אמיתי משיפוד מעץ, מים מלוכלכים ולייזר פויינטר (זהירות לא לכוון לעיניים). ספרו לנו בתגובות איך יצא!

למידע והסברים בקרו כאן
לניסויים נוספים בקרו במדע בבית

 

05/07

טיול מדעי: חוף הים (המלצה שלנו - חוף פלמחים)
הגיע הסופ"ש, יהיה חם זה הזמן ללכת לים! הפעם כשאתם הולכים לים קחו אתכם גם את מדריך הקייטנה לצדפים.
והנה פרט קטן שבטח לא ידעתם: ה"צדפים" השכיחים ביותר על חופי ישראל הם קונכיות של צדפת המים המלוחים נַעֲמִית (Glycymeris), ובפרט של המין נעמית מצויה. הקונכיות הלבנבנות-חומות האלה שכיחות ומוכרות לנו מאוד, אולם פרטים חיים של נעמית מצויה לא נראו באזורנו זה למעלה מ-50 שנה. מין זה נכחד מהאזור, והסוג כולו הולך ונכחד.
למידע נוסף על צדפים, חול ומלח בחוף הים

 

04/07

תופסים גלים: מכונת גלים מדובוני גומי   

מעבר להיותם של דובוני גומי ממתק טעים (ולא בריא) אפשר להשתמש בהם גם כמודל לגלים. במקום גלי ים - גלי דובוני גומי :-)

מה צריך?

חבילה של דובוני גומי

שיפודים

נייר דבק מסוג מסקינגטייפ

מה עושים?

נועצים בכל שיפוד שני דובוני גומי, קרובים לקצוות. מניחים את השיפודים במרווחים שווים על נייר הדבק (כמו בתמונה). את קצה המתקן שבניתם מדביקים למעקה, שולחן או כל דבר יציב אחר, ותופסים אותו מהקצה השני. מנענעים בעדינות את הצד שאתם מחזיקים, ומקבלים תנועה של גל. תוכלו לנסות כל מני תנועות: מעלה-מטה, לצדדים, בקצב משתנה ועוד. שימו לב באיזה כיוון זזים הדובונים וכתבו לנו בתגובות מה ראיתם.

 

 

להסבר על תופעת הגל העומד
לאפליקציה שממחישה תנועת גלים
לניסוי בנית צפצפה (גלי קול)

ניסוי זה נערך במסגרת פעילות גלי קול של מסלול שביט למצויינות מדעית

 

03/07

בקייטנה היום נלמד איך רולנדו מבקיע בעיטת בננה, למה מרטיבים את המגרש והאם הכדור באמת עגול? לכבוד המונדיאל, בואו לגלות את נקודות המפגש בין כדורגל למדע, בפעילות דיגיטלית מגניבה (מצריך הרשמה, ללא תשלום)

רוצים עוד? קבלו! פעילות בונוס מיוחדת

02/07
החידה של יום שני

איך לחצות את הערוץ?
במהלך סיור על מאדים נתקלה משפחת ווטני בבעיה. הם היו צריכים לחצות ערוץ עמוק ותלול
תוך שימוש ברובר קטן שיכול לשאת 30 ק"ג בלבד.
מרק ווטני ולינדה ווטני שניהם בעלי משקל זהה: כל אחד מהם שוקל על כדור הארץ 79.7 קילוגרם, כך שמשקלם על מאדים בדיוק 30 ק"ג.
כל אחד משני הבנים שלהם, ניל ובאז, שוקל על מאדים בדיוק 15 ק"ג, והמשפחה צריכה להעביר גם את רובוט המחקר הקטן.
כתבו לנו בתגובות איך משפחת ווטני צריכה לחצות את הערוץ.

החידה פורסמה לראשונה במסגרת מתמטיקה בהתכתבות

 

01/07/2018

ליום הראשון בחרנו עבורכם ניסוי מגניב! בניסוי הזה נבנה כוס מיוחדת שמתרוקנת מעצמה ברגע שהמים מגיעים בה לגובה מסוים. הכוס הומצאה ביוון לפני יותר מאלפיים שנה ומשמשת עד היום בכל מכונת כביסה.

כתבו לנו בתגובות אם הצלחתם

ניסוי זה נערך במסגרת ניסויי מדע בבית

רוצים לדעת עוד?

בקרו בכתבה

 

 

18 תגובות

  • נדב מיכוב

    אגסים ותפוחים-תשובה

    יישאר תפוח אחד

  • מומחה מצוות מכון דוידסוןרוויטל

    תשובה

    נכון מאוד!!
    אם קוטפים פרי אחד אין שינוי, אם קוטפים שני פירות יש שתי אפשרויות:
    נניח שלוקחים פירות זהים, מ-20 אגסים יוצאים 10 אגסים וממספר אי-זוגי של תפוחים תמיד יישאר תפוח אחד שאין לו זוג, עד שבסוף נשאר תפוח ואגס אחד שיתנו תפוח.
    גם אם לוקחים זוגות של אגס ותפוח ביחד, נקבל אגסים במקומם ושוב נחזור למצב של אי-זוגיות באגסים ובסוף נישאר עם תפוח ואגס אחד שמהם יוצא תפוח.
    לכן יוותר בוודאות תפוח על העץ ולא אגס.

  • נדב מיכוב

    החולד הוא החיה שנמצאה☺☻

  • מומחה מצוות מכון דוידסוןרוויטל

    תשובה

    נכון!! יפה מאוד!
    וסתם לידע כללי -
    בארץ אין חפרפרות ואת כל תלוליות העפר יוצר החולד :)

  • נחום

    פתרון לחידה "הנוסע האחרון"

    מאחר וידוע לי שכל המקומות של שאר האסטרונאוטים (חוץ מהראשון והאחרון) תפוסים, מכאן יש להסיק אחד מתוך השניים:
    א. המקום שנשאר הוא המקום של האסטרונאוט הראשון.
    ב. המקום שנשאר הוא המקום של האסטרונאוט האחרון.

  • מומחה מצוות מכון דוידסוןרוויטל

    תשובה

    נכון! אם הנוסע האחרון לא התיישב בכיסא המיועד לו, הוא בהכרח התיישב בכיסא פנוי שבעליו המקורי כבר ישב בכיסא אחר. הכיסא היחיד במטוס שיכול להיות בסטטוס הזה הוא הכיסא שהיה מיועד לנוסע הראשון.

  • נחום

    פתרון לחידה "מי אסף יותר עפרות מתכת?"

    סדר הרובוטים הוא: CBEDAF

  • מומחה מצוות מכון דוידסוןרוויטל

    תשובה

    נכון! לגמרי התלמיד המצטיין של הקייטנה :)

  • נחום

    פתרון לחידה "שולחן עגול"

    סדר ישיבת האסטרונאוטים סביב השולחן הוא: אלן, ג'ון, גאס, סקוט.

  • מומחה מצוות מכון דוידסוןרוויטל

    תשובה

    נכון! אבל..... יש תנאי מסוים שחייב להתקיים, מהו?

  • נחום

    שאלן יושב מול גאס, וג'ון מול

    שאלן יושב מול גאס, וג'ון מול סקוט... (השולחן עגול. כבר אמרנו?)

  • מומחה מצוות מכון דוידסוןרוויטל

    תשובה

    השולחן עגול זה נכון, אבל הסדר חייב להיות בהתאם לכיוון השעון :)

  • שרון בן מרדכי

    היי, האם אוכל לרשום את ביתי

    היי, האם אוכל לרשום את ביתי לקייטנה ? במידה וכן,אשמח לקבל פרטי התקשרות

  • מומחה מצוות מכון דוידסוןרוויטל

    תשובה

    היי שרון, הקייטנה היא קייטנה ווירטואלית חינמית, אך בגן המדע שלנו מתקיימות סדנאות קיץ מדעיות, מוזמנת ליצור קשר:
    08-9378300 מצפים לכם!

  • מיכל, אורי, שחר...

    התשובה שלנו לחידה

    בהתחלה האמא עוברת עם אחד הילדים. היא משאירה אותו בצד השני, וחוזרת לקחת את הילד השני. אח"כ הילד הראשון הולך לקחת את האבא ושניהם חוזרים יחד עם הרובוט. כולם בצד השני! יש!

  • מומחה מצוות מכון דוידסוןרוויטל

    תשובה

    ממממממממ נסו שוב :)

  • מיכל, אורי, שחר...

    שאלות על הניסוי

    הי!
    תודה רבה על הניסוי. עשינו אותו והצלחנו נהדר, וגם חזרנו עליו כמה פעמים. האם תוכלו להרחיב לגבי חוק הסיפון? את חוק כלים שלובים אנחנו מכירים אבל את חוק הסיפון פחות. תודה!

  • מומחה מצוות מכון דוידסוןארז גרטי

    תשובה

    הי
    יש לנו כתבה (וניסוי המשך) בדיוק על זה :-)
    https://goo.gl/PGQnQz

    אם יש לך שאלות נוספות נשמח לעזור
    ארז